What Is Plum Pox: Learn About The Control Of Plum Pox Disease


Plums and their relatives have long been troubled by various diseases and pests, but it wasn’t until 1999 that the plum pox virus was identified in North American Prunus species. Control of plum pox disease has been a long process in Europe, where it appeared in 1915. The battle has only just begun in American orchards and nurseries, where aphids transmit this disease between closely spaced plants.

What is Plum Pox?

Plum pox is a virus in the genus Potyvirus, which includes several commonly known mosaic viruses that infect garden vegetables. It is generally only transmitted over short distances, since it remains viable for just a few minutes inside the aphids that transmit the virus, such as green peach and spirea aphids.

Aphids spread plum pox virus when they probe infected plant leaves for potential food sources, but move from the plant instead of settling down to feed. This may result in multiple infection sites in a single tree, or a spreading infection in trees that are planted closely together.

Plum pox is also frequently spread through grafting. When plants affected by plum pox, including cherries, almonds, peaches and plums, are initially infected with plum pox virus, symptoms may be hidden for three years or more. During this time, the quietly infected trees may be used for creating multiple grafts, spreading the virus far and wide.

Treating Plum Pox

Once a tree is infected with plum pox, there is no way to treat it. That tree, and any nearby, should be removed to stop the spread of the virus. Symptoms are often delayed, but even when they appear, they are sporadic, making diagnosis difficult. Look for discolored rings on leaves and fruits, or color breaking on flowers of ornamental peaches, plums and other Prunus species.

Unless you live in a plum pox virus quarantine area, including parts of Ontario, Canada, Pennsylvania and Michigan, your sick Prunus species is unlikely to be affected by this specific virus. However, controlling aphids on all plants is generally good practice, since their feeding can transmit other illnesses and cause general decline of infested landscaping.

When aphids are detected, knocking them from plants with a garden hose every few days or treating affected trees weekly with neem oil or insecticidal soaps will keep their numbers low. Once knocked back, beneficial insects can move in and provide regular control, as long as you refrain from using broad-spectrum pesticides nearby.


Peach (Prunus persica)-Plum Pox (Sharka)

Cause Plum pox virus (PPV) of which there are several strains. The disease was found in North America for the first time in 1999 in Pennsylvania and has now been detected in New York and Michigan as well as Ontario and Nova Scotia, Canada. Periodic surveys for the virus since 2000 have not found the virus in the Pacific Northwest nursery industry or Oregon's cherry orchards. After 10 years of eradication efforts, Pennsylvania was declared free of the virus in 2009 meeting the requirement of three consecutive years of testing negative. Michigan has also eradicated the disease. There are 7 strains known including PPV-D, which is the one found in the US. Globally, PPV is the most economically important virus of stone fruits.

PPV infects all Prunus fruit tree species, almond, and many ornamental trees. In Europe, wild Prunus species are reservoirs of the virus. Herbaceous hosts include an array of common weeds, such as white clover and nightshades. The virus can survive in the roots of rogued infected trees and can also spread by natural root grafting. Suckers produced from the remaining roots of rogued infected trees carry the virus and therefore must be removed if control is to be achieved.

PPV is transmitted by aphids in a nonpersistent manner and is retained by the aphid for no more than a few hours. Aphids appear to spread the virus not to immediately adjacent trees but to trees several spaces away. Systemic spread of the virus within a tree may take several years in the meantime, the virus may be distributed very irregularly. Seed transmission in Prunus is known not to occur with the D strain, but there are some reports of seed transmission with the M strain. Long-distance spread is through distribution of infected budwood and nursery stock. Experimental transmission from infected fruit to hosts has been shown and could be a possible mechanism for long distance spread.

Symptoms Many trees do not show symptoms for up to 4 years after initial infection. Symptoms can be severe on many cultivars of apricot, plum, and peach trees. However, the type and severity of symptom development depends on the particular cultivar. Sweet and sour cherries were confirmed as natural hosts. Symptoms may appear on leaves or fruits of infected trees and are particularly evident on leaves in spring when chlorotic spots, bands or rings, vein clearing, and even leaf deformation is evident. Infected fruits show chlorotic spots or rings, and diseased plums and apricots are deformed with internal browning of the flesh and pale rings or spots on the stones. Much of the affected fruit drops prematurely, 20 to 30 days before the normal maturity date, and fruit that does remain on the tree lacks flavor and is low in sugar. Symptoms however, are highly variable.

Controls The best control is preventing introduction. At all times use propagative material that has been tested and found free of all known viruses this is fundamental to preventing introduction to new areas. If introduced, an aggressive eradication program is exercised.

Reference Mavrodieva, V., James, D., Williams, K., Negi, S., Varga, A., Mock, R., and Levy, L. 2013. Molecular analysis of a Plum pox virus W isolate in plum germplasm hand carried into the USA from the Ukraine shows a close relationship to a Latvian isolate. Plant Disease 97:44-52.


Plum Pox Virus - Caring For Plants Affected By Plum Pox Disease - garden

A dental checkup every 6 months can save money and time—and sometimes, agony later. Ditto for an annual physical exam. These preventive measures can identity, and often take care of, human health problems before they occur.

Some ARS crop research is also like that.

For example, ARS horticulturist Ralph Scorza, with help from French collaborator Michel Ravelonandro, has been working for the past 5 years on protecting U.S. fruit growers from plum pox virus. Though this deadly virus has not yet appeared in North America, it is now spreading in orchards throughout Europe. Recently, the virus was discovered in South America.

Primus crops, which include plums, peaches, and apricots, brought U.S. growers about $712 million in 1994.

Plum pox—sometimes known as Sharka—virus causes fruit to drop from affected trees 20 to 40 days before maturity, and it leaves the remaining fruit unmarketable. The disease is transmitted by aphids and by grafting.

"This virus causes severe damage and crop loss in plums, peaches, and apricots," Scorza says. "There is no remedy, once it attacks a tree."

But there may he a preventive strategy: Scorza and his colleagues have recently developed transgenic plum plants that resist the virus.

A coating of protein usually surrounds a virus, Scorza says. The scientists put a gene from part of the protein coat of the papaya ringspot virus into 36 plum trees in 1990. Similar genes have been used in other crops to protect them against other viruses.

Scorza nurtured the new transgenic plum trees in greenhouses at the ARS Appalachian Fruit Research Station in Kearneysville, West Virginia.

Later, under very strict quarantine at ARS' Foreign Disease-Weed Science Research Laboratory in Frederick, Maryland, plant pathologist Vernon D. Damsteegt inoculated the transgenic trees with plum pox virus to test their resistance.

"For up to 19 months, one plant remained virus free then it succumbed, as had all the others at various stages," Damsteegt reports.

In testing the new plants in the United States, Scorza worked closely with Damsteegt and with Laureen Levy, a plant virologist with USDA's Animal and Plant Health Inspection Service at Beltsville. Maryland.

"What we had was a gene that would delay the symptoms of the disease but, in the long run, wouldn't prevent the virus from attacking," Scorza says.

For crops like tomatoes, where you produce new plants each year, this symptom delay might he very helpful. But tree crops take years to produce an initial yield, and the same trees produce year after year. Scorza says fruit trees would need the disease resistance to hold up for years.

So—back to the drawing board.

Working with Ravelonandro, who is with the INRA Centre de Recherché Agronomique in Bordeaux, France, Scorza got the gene for the coat protein directly from the plum pox virus. INRA is the French equivalent of the Agricultural Research Service.

"We then put this new gene into plum trees here in the lab and sent seedlings to France to be tested with the virus," says Scorza. "After 2 years of tests, we had one breeding line that appears to have complete immunity to plum pox virus."

This line will now be tested in Central European countries where the virus is rampant.

But Scorza says that further work is necessary to breed these new transgenic plants for fruit quality. "We'll he doing that here, as well as in France."

Levy, Damsteegt, and Scorza evaluate the resistance of the new transgenic hybrids at the ARS quarantine facility in Frederick. "It's good to know that we now have a pretty good handle on this situation and have some control strategies ready, if plum pox hits our orchards," Scorza says.—By Doris Stanley. ARS.

Ralph Scorza is at she USDA-ARS Appalachian Fruit Research Station, 2217 Wiltshire Road, Kearneysville, WV 25430: phone (304) 725-3451 ext. 322.

Vernon D. Damsteegt is at the USDA-ARS Foreign Disease-Weed Science Research Laboratory, Fort Detrick, Maryland

"A Cure for Plum Pox Virus" was published in the March 1996 issue of Agricultural Research magazine.


Introduction

Animal and plants possess an elaborate immune system, whose first layer enables the identification of pathogens by pattern recognition receptors (PRRs) that perceive pathogen‐associated molecular patterns (PAMPs) (Kumar et al., 2011 Zipfel, 2014 ). Once activated, PRRs trigger signalling cascades that launch transcriptional and physiological changes within host cells, ultimately hampering pathogen growth and establishing PAMP‐triggered immunity (PTI). To counteract this defence strategy, successful pathogens deploy a range of effectors, the primary function of which is to evade/interfere with PTI (Jones and Dangl, 2006 ).

The best‐studied PTI pathway in plants relies on the Arabidopsis receptor kinase FLAGELLIN‐SENSING 2 (FLS2), which perceives bacterial flagellin (or its active epitope flg22) (Gómez‐Gómez et al., 2000 Zipfel et al., 2004 ). FLS2 activation requires the association with the co‐receptor BRI1‐ASSOCIATED KINASE 1 (BAK1), or its closest paralog BAK1‐LIKE 1 (BKK1), within plasma membrane (PM)‐localized PRR complexes (Chinchilla et al., 2007 Heese et al., 2007 Roux et al., 2011 Sun et al., 2013 ). Activated FLS2 dissociates with the receptor‐like cytoplasmic kinases (RLCKs) BOTRYTIS‐INDUCED KINASE 1 (BIK1) and AVRPPHB SUSCEPTIBLE 1‐LIKE 1 (PBL1) (Kadota et al., 2014 Li et al., 2014 Lu et al., 2010 Zhang et al., 2010 ). The following downstream cascade comprises a reactive oxygen species (ROS) burst, activation of mitogen‐activated protein kinases (MAPKs) and transcriptional reprogramming (Bigeard et al., 2015 ).

Over the last 20 years, it has become clear that PTI mechanisms allowing both plants and animals to resist pathogen attacks follow conserved signalling strategies (Arpaia and Barton, 2011 Lester and Li, 2014 Schwessinger and Ronald, 2012 Thompson et al., 2011 Zipfel and Felix, 2005 ). Antiviral PRR pathways have been studied extensively in mammals, and the mechanisms whereby viral effectors manipulate PTI defences have been well characterized (Harris and Coyne, 2013 Hiscott et al., 2006 Kumar et al., 2011 Schröder and Bowie, 2007 Yokota et al., 2010 ). In contrast, hardly anything is known in plants, although indications concerning the existence of PTI mechanisms targeting plant viruses have emerged recently (Kørner et al., 2013 Nicaise, 2014 Zvereva and Pooggin, 2012 ).

Plant antiviral defences rely mainly on RNA interference, in which the cellular machinery targets virus‐derived nucleic acids, and resistance (R) proteins which recognize virus avirulence factors and trigger an array of physiological and biochemical defence processes broadly targeting pathogens (Nicaise, 2014 ). Interestingly, a recent model hypothesizes: (i) the action of PTI mechanisms within plant immunity against viruses in parallel with RNA interference and R proteins and (ii) the existence of specialized effectors encoded by successful plant viruses to bypass PTI, in parallel with the well‐characterized viral silencing suppressors (Nicaise, 2014 Zvereva and Pooggin, 2012 ).

Potyviruses constitute one of the largest and most successful genera of plant viruses (Revers and García, 2015 ). Their single‐stranded RNA genome is packed into filamentous particles and encodes 11 highly multifunctional proteins (Charon et al., 2016 ), including the capsid protein (CP), which is primarily characterized by its structural role in forming the protective shell around the viral genome. In addition to being the causal agent of Sharka, the most damaging viral disease affecting stone fruit trees, Plum pox virus (PPV) is a representative model of RNA viruses, a dual feature that has led to its classification among the Top 10 plant viruses of scientific and economic importance (Decroocq et al., 2006 García et al., 2014 Rimbaud et al., 2015 Scholthof et al., 2011 ).

We address here the question of the existence of virus‐encoded effectors suppressing PTI mechanisms, using the Arabidopsis thaliana–PPV pathosystem. In this report, we show that: (i) PTI genes contribute to Arabidopsis immunity to PPV (ii) PPV suppresses early PTI responses during plant infection and (iii) PPV CP acts as an effector suppressing PTI mechanisms, underlining a novel strategy employed by a plant virus to counteract host defences.


Material and Methods

Plant material

The plant material consisted of two apricot genotypes, ‘Rojo Pasión’ and ‘Z506-7’, obtained from the cross between the North American cultivar ‘Orange Red’ (resistant to PPV) and the Spanish cultivar ‘Currot’ (susceptible to PPV) [3]. Experiments were performed in controlled greenhouse conditions in the Experimental Field of CEBAS-CSIC at Santomera (Murcia, Spain). ‘Rojo Pasión’ is self-compatible and early blooming and has an intermediate-sized oblong fruit with yellow skin, intense red blush and a light orange flesh colour. This genotype is characterised by its resistance to PPV [32]. ‘Z506-7’ is also self-compatible and early blooming and has a fruit similar to that of ‘Rojo Pasión’ and characterised by its great susceptibility to PPV [5]. In addition, a preliminary characterization using 61 different SSR markers showed a percentage of 72% of SSR alleles in common (S1 Table). Finally, ‘Real Fino’ apricot seedlings, which are very susceptible to PPV, were used as rootstock.

PPV evaluation procedure

Plant inoculations were carried out in the ‘Real Fino’ rootstocks using the PPV-D strain 3.30 RB/GF-IVIA (GenBank: KJ849228.1). Four replications of two-month-old ‘Real Fino’ seedling rootstocks grown in 3.5L pots were inoculated by grafting a piece of bark from other previously infected ‘Real Fino’ plants showing strong sharka symptoms. Two additional seedlings were kept as controls. Two months later, six replicates of clonal ‘Rojo Pasión’ and ‘Z506-7’ were grafted onto the previously inoculated and control ‘Real Fino’ seedling rootstocks. One month after grafting, plants were subjected to an artificial period of dormancy in darkness at 7°C for two months before being transferring again to the greenhouse. After two months in the greenhouse, sharka symptoms on leaves were scored using a scale from 0 (no symptoms) to 5 (maximum intensity). The presence of PPV was confirmed by DASI-ELISA with the specific monoclonal antibody 5B-IVIA/AMR (Plant Print Diagnostics SL, Valencia, Spain) and RT-PCR analysis using specific primers for the coat protein VP337 ( 5’ CTCTGTGTCCTCTTCTTGTG 3’ ) and VP338 ( 5’ CAATAAAGCCATTGTTGGATC 3’ ). At this moment, leaves were collected in all of the assays performed: SSR analysis, RNA-Seq and qPCR assay.

High-throughput RNA sequencing

The apricot samples analysed included ‘Rojo Pasión’ (R, resistant to PPV) and ‘Z506-7’ (Z, susceptible to PPV) apricot cultivars grafted onto healthy (c, control) and PPV inoculated (i, inoculated) ‘Real Fino’ apricot seedling rootstocks. Control replicates did not show sharka symptoms and were ELISA an RT-PCR negative. In the inoculated treatments ‘Z506-7’ replicates showed strong sharka symptoms (3.5 on a scale of 0 to 5) and were ELISA and RT-PCR positive, whereas ‘Rojo Pasión’ replicates did not show sharka symptoms and were neither ELISA nor RT-PCR positive. Two replications were assayed for each treatment. Leave samples from each replication were frozen in liquid nitrogen and stored at -80°C, and total RNA was extracted using the Rneasy Plant Mini Kit ® (Qiagen, Hilden, Germany). The quality and quantity of total RNA samples were assessed using a NanoDrop ® 2000 spectrophotometer (Thermo Scientific, Wilmington, USA) and normalised at the same concentration (5μg, 200 ng/μl). RNA samples were sent to the Scientific Park of Madrid (Spain) (http://www.fpcm.es/es/servicios-a-la-id/servicios/genomica) for library preparation and RNA sequencing. The cDNA libraries were sequenced using an Illumina HiSeq2000 machine to perform 100 paired-end sequencing.

Bioinformatic analysis

A quality control was performed for the RNA-Seq reads using FastQC software. Pre-processing of the reads was performed with the fastx-toolkit (http://hannonlab.cshl.edu/fastx_toolkit/) in order to filter low quality regions. High quality reads were mapped to the P. persica genome v1.0 obtained from the Genome database for Rosaceae (GDR, http://www.rosaceae.org/peach/genome) [33] using Tophat 1.4.0 [34] and Bowtie 0.12.7 [35]. Variant calling analysis from read mapping files was performed using Samtools 0.1.18 [36]. High quality variants were obtained after filtering SNPs with quality scores > 20 and INDELs with scores > 50. Differential gene expression (DE) was calculated with the program Cufflinks 1.3.0 [37]. The resulting lists of differentially expressed isoforms were filtered by log2 (log fold change) >2 and ® on three control (Rc and Zc) and inoculated plants (Ri and Rc). Reverse transcription was conducted using the PrimeScript ® Reverse Transcriptase Kit (Invitrogen, Applied Biosystems, Madrid, Spain). Eight genes specifically expressed in the different treatments with q-values (CqGOI) / EREF ^ (-CqREF) from Pfaffl [43]. Three independent biological replicates with at least two technical replicates were performed for each sample. The Cq for the reference normalisation factor (denoted as REF) was calculated by taking three reference genes: peach 18S rRNA [44] actin and expansin [45]. To test the effect of the cultivar and the infection, a one-way analysis of variance (ANOVA) was performed. Means were separated by Fisher's protected LSD test at p Table 1. Mapping characteristics of ‘Rojo Pasión’ (resistant to PPV) and ‘Z506-7’ (susceptible to PPV) apricot genotypes and PPV reads to the reference peach genome (P. persica v 1.0) and the assayed PPV genome (GenBank: KJ849228.1), in the biological replications of the four samples assayed using RNA-Seq.

By iterative alignment, an average of 68.8% of the clean reads were successfully mapped to the v1.0 peach reference genome (http://www.rosaceae.org/), confirming the important level of synteny between Prunus genomes [46] and the utility of the peach genome as reference in RNA-Seq studies in different Prunus species. Of the unmapped reads, a total of 18.87 million (5.6%) reads derived from the two ‘Z506-7’ apricot samples inoculated with PPV and showing sharka symptoms mapped to the PPV genome (GenBank: KJ849228).

Percentages of mapped RNA-Seq reads in apricot obtained in this work were similar to the 70% mapped reads reported after the apricot transcriptome was explored in similar genotypes using a single 35 nt sequencing protocol [29] but lower than the 89% and 85% reported in peach by Wang et al. [47] and Rubio et al. [31], respectively. However, the mapping percentages in this study were higher than the 50% mapped reads previously reported in Japanese apricot (P. mume Sieb. et Zucc.) [48].

SNPs identification

RNA-Seq clean reads from the four treatments in this study were used for Single Nucleotide polymorphism (SNP) and insertion/deletion (INDEL) identification in transcribed regions using the reported peach genome as a reference. A total of 283,057 and 293,565 variations were identified in the transcribed regions (exons) of ‘Rojo Pasion’ and ‘Z506-7’, respectively. Out of these variations, 277,792 were SNPs (98%) and 5,266 were INDELs (2%) in ‘Rojo Pasión’ and 287,626 were SNPs (98%) and 5,939 were INDELs (2%) in ‘Z506-7’. The SNP density was one SNP per 1.0 kb. The highest SNP density was detected in scaffold 1, with 63,140 SNPs identified in the resistant genotypes and 65,402 SNPs in the susceptible genotypes. Scaffold 1 was followed by scaffolds 6 and 4, with more than 30,000 SNPs identified in each region (Table 2). We also identified 124 SNPs specific to the resistant genotype ‘Rojo Pasión’ in the PPVres region in scaffold 1 (region of 196 kb) (S3 Table). These SNPs can be used to identify candidate genes that may be responsible for PPV resistance.

One of the 124 SNPs identified in the resistant genotype ‘Rojo Pasión’ in position 8,232,989 of the peach reference genome agrees with the findings of Zuriaga et al. [22], who also identified SNPs in this region after the whole genome sequencing (WGS) of nine different resistant and susceptible apricot genotypes. In addition, another seven SNPs were identified in ‘Rojo Pasión’ with a difference of just one bp with respect to the data of Zuriaga et al. [22] in positions 8,080,435 8,081,455 8,097,511 8,099,699 8,106,977 8,115,154 and 8,133,375 respectively. However, none of the 124 specific SNPs matched with the two SNPs identified in the positions 8,156,254 and 8,157,485 of the resistant genotype ‘Lito’ used in MAS for PPV resistance by Decroocq et al. [4]. In addition, only one specific SNP identified in position 11,597,304 (specific of the resistant cultivar ‘Rojo Pasión’) coincided with the candidate SNP proposed by Mariette et al. [49] after genome-wide association analysis of 72 apricot accessions resistant and susceptible to PPV.

Recently a powerful and flexible tool for SNP analysis using SNPlex ™ high-throughput genotyping technology has been tested in apricot [50]. This technology makes it possible to quickly and easily analyse individual SNPs in apricot genotypes, and it could be used for the genotype and progeny screening of the 124 potential SNPs described in the present work.

Host transcriptional changes in resistant and susceptible apricot genotypes PPV infected

A total of 13,153 differentially expressed genes (DEGs) were identified in the following comparisons: i) ‘Rojo Pasión’ control vs. ‘Rojo Pasión’ inoculated (Rc vs. Ri) ii) ‘Z506-7’ control vs. ‘Z506-7’ inoculated (Zc vs. Zi) iii) ‘Rojo Pasión’ control vs. ‘Z506-7’ control (Rc vs. Zc) and iv) ‘Rojo Pasión’ inoculated vs. ‘Z506-7’ inoculated (Ri vs. Zi). After filtering the data (fold change ≥ 2 or ≤ -2 and q-val Table 3. Total and filtered differentially expressed genes (DEGs) from the four apricot samples assayed [‘Rojo Pasión’ (resistant to PPV) control and inoculated and ‘Z506-7’ (susceptible to PPV) control and inoculated] in the four comparisons performed.


Plum Tree Pest and Disease Guide

Many pests and diseases affect plum tree. Plums are a stone fruit, and several diseases can be transferred between stone fruit trees. Here is some information on diseases to look out for as well as some pest control instructions to keep your crop healthier.

Bacterial Spot

Bacterial spot can make stone fruit trees loose foliage and bear little fruit. It tends to form on trees in more humid areas. There is no cure for bacterial spot—you can only prevent it by treating with chemical sprays and trying to lower the humidity.

Black Knot

Black Knot is a fungal disease that attacks the wood of the tree. It will attack branches and the trunk, forming gnarled knotty growths of fungus around the stem. Treat with fungicide and cut the branch away at least 4 inches below the root knot. If possible, keep the infected tree away from other trees.

Brown Rot

Brown rot is another fungal disease that covers the fruit in brown fungus-looking patches. It can invade a whole tree or orchard if not properly pruned or cleaned. Use fungicide to treat a tree and make it less susceptible to getting brown rot.

Crown Gall

Crown gall is the collection of gall on the roots or base of the trunk. These are soft and spongy and cause more damage to new trees than old. There is no treatment if your plum tree develops this—only preventive measures to avoid and check for it on new crops.

Plum Pox Virus

Plum pox is a disease that can not be killed. Once it infects a tree or crop, the trees must be destroyed immediately. The disease is spread by aphids and can be carried pretty far away from the source. Prevent it by keeping aphids away from your trees.

Aphids

Aphids feed on the foliage of your plum tree and they can indeed pose a problem in large quantities. To get rid of them, use a spray solution of soap and water to act as a pesticide. There are also commercial insecticide sprays that discourage aphid infestations.

Ants are attracted by rotting fruit and by aphid populations. If you keep your fruit cleaned and control aphids, an ant problem will likely go away on its own.

Japanese Beetle

Japanese beetles will eat the leaves as well as all of the flowers and fruit if they are left to do so. There are pesticides that you can use as well as beetle traps that lure the bugs with pheromones.

Bees and Wasps

Bees and wasps are not an enemy to your plum tree. The bees are pollinating fruits and flowers, and the wasps are eating, too. Unless they become a huge problem, leave these insects alone.


Conclusions

From the methodological point of view, RNA-Seq has proven to be a very powerful tool in the analysis of the PPV/apricot interaction, although it is not the definitive tool for solving the gene expression base and the genomic determinants of this trait. This technique is nevertheless an important complementary tool to other means of studying genomics that produce lesser amounts of data, static behaviour and clearer polymorphisms between genotypes. An integrated approach should compensate for the main disadvantages of using RNA-Seq as an analysis tool, such as the high amount of data, the dynamism of transcriptome expression, and the complexity of regulation. In this study, transcriptomic differences at the gene expression level confirmed that susceptibility to PPV in apricot is a complex process based on a continuous battle between the virus (PPV) and the plant (Prunus) at the pathogen resistance gene level (allene oxide synthase, the S-adenosylmethionine synthetase 2 and the major MLP-like protein 423) and gene silencing level. This response is similar to the response observed in peach. On the other hand, resistance to PPV in apricot is also a complex process that could involve MATH genes (which control the long-distance movement of viruses). Furthermore, other genes inside (Pleiotropic drug resistance 9 gene) or outside (CAP, Cysteine-rich secretory proteins, Antigen 5 and Pathogenesis-related 1 protein and LEA, Late embryogenesis abundant protein) PPVres region could also be involved in the resistance.


Watch the video: Plumpox virus


Previous Article

Rowan

Next Article

Cintia